Puoli vuotta pandemiaa – viruksen käyttäytymisessä on yhä niin paljon kysymyksiä, että vauhtisokeus saa tutkijat julkaisemaan jopa aivan roskaa

SARS-CoV-2-viruksen perimä on avattu eri puolilla maailmaa kymmeniätuhansia kertoja.

koronavirus
The Lancet ja The New England Journal of Medicine -lehtien ilmoitus tutkimusten perumisesesta. Päällä iso punanen leima "retracted" eli vedetty takaisin.
Heinäkuun alussa oli COVID-19-tutkimuksen noloin päivä: maailman kaksi arvostetuinta lääketieteellistä lehteä veti samana päivänä takaisin kaksi tutkimusartikkelia.Anniina Wallius / Yle

Puoli vuotta sitten Maailman terveysjärjestö pani hälytyskellonsa moikaamaan havahduttaakseen hallitukset tajuamaan, miten poikkeuksellisesta taudista COVID-19:ssä on kyse. Maaliskuun 11. päivänä WHO:n pääjohtaja Tedros Adhanom Ghebreyesus julisti COVID-19:n pandemiaksi (siirryt toiseen palveluun).

Tiedemaailma tunsi vihollisen sisuskalut jo kaksi kuukautta aiemmin. Silloin kiinalaistutkijat olivat julkistaneet Wuhanissa eristetyn SARS-CoV-2-viruksen sekvensoidun genomin (siirryt toiseen palveluun) eli viruksen perimän. Ensimmäinen tautitapaus oli diagnosoitu joulukuussa.

Ihmisen genomin kirjainjonossa on 3,2 miljardia merkkiä. Niiden sekvensointi vaati toistakymmentä vuotta kansainvälistä työtä. Tulos on avannut ovia ihmisten perinnöllisten sairauksien ymmärtämiselle ja hoidolle.

SARS-CoV-2:lla kirjaimia on alle 30 000. Vanhastaan tunnettujen koronavirusten perusteella tiedettiin myös olettaa, että perimässä tapahtuisi erittäin vähän mutaatioita, jotka vaikuttaisivat viruksen biologisiin ominaisuuksiin.

Höyhensarjan vastustajastako siis on kyse, ja vieläpä sellaisesta, joka ei väistele iskuja? Tutkittukin sitä on valtavasti enemmän kuin mitään muuta virusta. Miksi se silti yhä hämmentää tutkijoita ja houkuttelee antamaan hätiköityjä vastauksia?

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

SARS-CoV-2:n RNA:n kirjainsarja, jonka avulla virus värvää ihmissolun proteiininsa monistajaksi.

Kaikki virukset muuttuvat. SARS-CoV-2:lla muutos on hidasta, vain noin kaksi mutaatiota kuukaudessa. Influenssaviruksella muutosvauhti on yli kaksinkertainen. Vain murto-osa mutaatioista vaikuttaa virusten fenotyyppiin, biologisiin ominaisuuksiin.

SARS-CoV:2 uutteralla sekvensoimisella on pysytty perillä siitä, mitä reittejä tartunnat ovat eri puolille maailmaa kulkeutuneet.

Minkään mutaation ei kuitenkaan ole pitävästi osoitettu muuttaneen perimää niin, että virus olisi muuttunut helpommin tarttuvaksi, saati vakavammaksi.

Virologin silmin virus on biologisesti edelleen ihan sama, joka joulukuussa lähti liikkeelle Wuhanista, sanoo Helsingin yliopiston uhkaavien infektiotautien apulaisprofessori Tarja Sironen.

Hyvin harvalla mutaatiolla on merkitystä

Vastauksia kysymyksiin COVID-19-tilanteen kehittymisestä kaivataan niin kiihkeästi, etteivät ainoastaan media ja sen kuluttajat tee perusteettomia päätelmiä, vaan samaan ovat langenneet monet tutkijatkin.

Tutkijoilla on käynnissä hirveä kilpailu tieteellisistä julkaisuista, sanoo Tarja Sironen.

– Kun jostakin tulee havainto mutaatiosta, siitä saatetaan tehdä tosi huonolaatuisia julkaisuja, joissa sanotaan, että virus on muuttunut. Ja siitä sitten spekuloidaan vähän liikaa.

Suurin osa mutaatioista on virusten kannalta huonoja. Niistä ei ole yleistymään.

– Viruksille on epätarkan kopiointimenetelmänsä takia luonnollista, että mutaatiota syntyy. Harvat kombinaatiot ovat virukselle edullisia ja pääsevät leviämään.

Suurin osa on niin sanottuja hiljaisia mutaatioita. Jokin nukleotidi muuttuu tai ehkä jokin aminohappokin, mutta ei se vaikuta virukseen mitenkään, Sironen kertoo.

Sattumanvaraisuuden vuoksi sekin on toisaalta mahdollista, että SARS-CoV-2:n mutaatiovauhti kiihtyy, jos viruksen proteiineihin sattuu sopiva muutos.

– Tai sattuu syntymään esimerkiksi variantti, joka säilyy elimistön ulkopuolella entistä pitempään. Monenlaiset ominaisuudet vaikuttavat siihen, kuinka hankala ongelma tämä virus on.

Soluviljelmä ei ole ihminen

Kesällä huomiota herättivät tutkimukset, joiden mukaan viruksen piikkiproteiinissa yksi aminohappo on muuttunut toiseksi, minkä pääteltiin kasvattavan tuntuvasti potilaiden viruskuormaa ja suorastaan lisäävän taudin tarttuvuutta.

Mutatoitunut variantti on jopa kymmenen kertaa tartuttavampi kuin se, joka todettiin alkujaan Wuhanissa, pääteltiin Cell-lehdessä julkaistussa kiinalaisessa tutkimuksessa (siirryt toiseen palveluun). Vastaavaa esitti yhdysvaltalais-brittiläinen tutkimus (siirryt toiseen palveluun) niin ikään Cell-lehdessä.

Tiedeyhteisö ei ole täysin vakuuttunut johtopäätöksistä. Laboratoriossa soluviljelyssä saatu tulos ei välttämättä tarkoita ihmisten keskuudessa samaa, kommenteissa huomautetaan.

– Yksi tutkija sanoi mielestäni hirveän hyvin, että ihmiset eivät ole Vero-soluja, sanoo Tarja Sironen.

Vero-soluja käytetään yleisesti soluviljelmissä, myös näissä SARS-CoV-2-tutkimuksissa. Nimi on lyhenne sanoista, jotka tarkoittavat vihreää munuaista, koska solut ovat peräisin vihermarakatin munuaisista.

SARS-CoV-2:stä tiedetään, että se alkaa soluviljelmässä adaptoitua hyvin nopeasti, Sironen kertoo.

– Se on siinä mielessä hyvin jännittävä virus. Se lähtee todella nopeasti adaptoitumaan uuteen eläinlajiin, olipa se sitten solumalli tai kokonainen eläin.

Elektronimikroskoopin kuvassa virukset on väritetty oransseiksi ja Vero-solut vaaleansinisiksi.
SARS-CoC-2-virukset valloillaan Vero-solujen joukossa. Elektronimikroskoopin kuvassa virukset on väritetty oransseiksi ja Vero-solut vaaleansinisiksi. NIAID

Eri puolilla maailmaa tehdyt sekvensoinnit osoittavat, että tutkimuksissa raportoitu piikkiproteiinin mutaatio on tosiaan yleistynyt voimakkaasti. Siitä voisi ehkä päätellä, että se leviää tehokkaasti, Tarja Sironen tuumii.

– On myös hieman potilasaineistoa, jonka perusteella voisi ehkä väittää, että uuden mutaation saaneissa potilaissa on muita suurempi virusmäärä. Mutta aineistot ovat hyvin pieniä, ja kysymysmerkkejä on paljon.

Mutaation vaikutuksesta taudin vakavuuteen ei sen sijaan ole lainkaan näyttöä. Olipa variantti kumpi tahansa, taudin vakavuus on samanlainen, Sironen korostaa.

– Taudin mahdollisesti herkempi leviäminen yksilöstä toiseen onkin sitten hankalampi kysymys. Sen voisi oikeastaan testata vain eläinmallissa. Jossakin eläinpopulaatiossa infektoitaisiin yksi yksilö kummallakin variantilla ja seurattaisiin, leviääkö jompikumpi toista tehokkaammin. Sellaista ei ole tehty.

Juuri nyt se ei edes ole prioriteetti, vaan tärkeämpää on testata rokotteita ja muita lääkeaineita, Sironen lisää.

Valtava aineisto, mutta ei kaikkialta

SARS-CoV-2:n genomi on avattu kymmeniätuhansia kertoja. Tarja Sironen kertoo, että hänen viime katsomallaan koko sekvenssejä oli jo yli 80 000.

– Kun vertaa vaikka myyräkuumevirukseen, jota olen aikaisemmin tutkinut, niin sen kokonaisia genomeja tunnetaan joitakin kymmeniä kaikkien näiden vuosien jälkeen, Sironen nauraa.

Sekvensointi ei hyödytä vain taudin leviämisreittien jäljittämisessä, vaan antaa tärkeää tietoa sekä rokotteen ja lääkkeen kehittäjille että diagnostiikalle. Nyt on jo nähty, että mutaatiot keskittyvät genomissa tietyille alueille.

PCR-testi, joka on diagnostiikassa tärkein nyt ja Sirosen mukaan varmasti jatkossakin, perustuu viruksen sekvenssiin, hän muistuttaa.

– Jos virus muuntuu niin, ettei testi tunnistakaan sitä, se huomataan sekvenssiä seuraamalla. Silloin pystytään kehittämään testiä niin, että se pysyy hyvänä ja herkkänä.

Valtava sekvensointimäärä ei silti tarkoita, että viruskanta oli tuttu kaikkialta maailmasta.

– Sekvenssiaineisto on tosi vääristynyt. Esimerkiksi Englannissa on ollut valtava projekti, josta on saatu tuhansia sekvenssejä, mutta monista muista maista niitä on vain kourallinen. Sekin pitäisi tutkijoitten muistaa.

Tarja Sironen, apulaisprofessori. Hgin yliopisto.
Apulaisprofessori Tarja SironenPekka Koli / Yle

Tarja Sironen tekee työssään paljon sekvenssi- ja mutaationalyyseja ja sanoo, että SARS-CoV-2:sta tulee tällä hetkellä hyvinkin ala-arvoisia julkaisuja.

– Niitä sitten vedetään pois. Se on harmillista.

Yleensä tiede on yhteispeliä, jossa toiset tutkijat arvioivat tuloksia ennen niiden julkaisua.

– Nyt on sellainen tilanne, että kaikki koronatutkijat ovat kiireisiä ja vertaisarvioinnitkin tehdään vähän sinne päin. Julkaisuun asti pääsee hyvin kyseenalaista materiaalia, ja tuntuu, että joka tasolla on kiire saada julkaisuja ulos.

Tässä tilanteessa julkaistaan normaalia enemmän myös niin sanottuja preprinttejä, vertaisarvioimattomia versiota. Jokainen tutkija on varmasti nyt oppinut katsomaan niitä uusin silmin, sanoo Tarja Sironen.

– Aluksi ne olivat hyviä, mutta tällä hetkellä ehkä yksi 50:stä on OK.

SARS-CoV-2 on ainutlaatuinen hyppääjä

Mikä tekee SARS-CoV-2:sta niin perin vakaan? Päätyikö virus ihmisiin jostakin syystä niin valmiina, ettei muutoksille kerta kaikkiaan ole enää tarvetta?

Sellaistakin on puntaroitu, että virus olisi kiertänyt Kiinassa jo hyvän aikaa aiheuttamatta isoa tartuntarypästä ja ehtinyt matkansa varrella kehittyä omalta kannaltaan parhaimmilleen.

Apulaisprofessori Tarja Sironen vastaa evoluutiobiologian termillä "fitness landscape". Sen mukaan viruksella tosiaan on kehityshuippunsa, jonka jälkeen kaikki mutaatiot heikentävät sitä. Silloin kaikki heikommat variantit häviävät ja virus pysyy stabiilina.

– Ihan hiljattain tuli tosi hyvä julkaisu nimenomaan tämän viruksen alkuperästä mielestäni maailman parhailta virusevoluution tutkijoilta. He olivat sitä mieltä, että virus on kiertänyt hyvin samanlaisena jo kymmeniä vuosia lepakoissa, Sironen kertoo.

Pieni muutos piikkiproteiinissa riitti antamaan virukselle kyvyn tarttua tehokkaasti myös ihmiseen ja ihmisestä toiseen.

– Tämähän on aivan ainutlaatuinen virus siinä suhteessa, että se tosiaan pystyy hyppäämään hyvin moneen eläinlajiin.

Tiilimuurin viereen kasattuja kuolleita minkkejä.
Minkkitilalla Ospelissa Hollannssa COVID-19-tartunnan takia tapettuja minkkejä. Ihmisen tavoin minkkikin voi olla oireeton tai sairastua vakavasti, muun muassa keuhkokuumeeseen.Rob Engelaar / EPA

Useilla hollantilaisilla minkkitiloilla virus ei ole tarttunut ainoastaan ihmisistä minkkeihin vaan myös minkeistä takaisin ihmisiin.

– Eihän mikään muu virus tällaiseen pysty! Yleensä lajihyppäystä pidetään viruksille pullonkaulana, mutta tälle se ei ole vaikeaa, sanoo Sironen.

Kyky lajihyppäykseen on havaittu tyypilliseksi muillekin koronaviruksille, mutta ei missään tapauksessa samassa määrin kuin SARS-CoV-2:lle, hän lisää.

Entä hyppäsikö SARS-CoV-2 lepakosta suoraan ihmiseen vai oliko sillä väli-isäntänä jokin eläin, kuten muilla koronaviruksilla, joita ihmisiin on tarttunut?

– Vastaus löytyy vain viruksen syntysijoilta, ja kiinalaiset tutkijat ovat ainoita, jotka sen voisivat meille kertoa. Nyt vain odotellaan, mitä sieltä löytyy, sanoo Tarja Sironen.

Mutaatioiden hitaus on etu rokotteelle

Koronaviruksen käytöstä ei voi ennakoida influenssavirusten perusteella, vaikka monet oireet ovat samanlaiset. Mutaatiotaipumuksessa ja siksi myös mutaatiovauhdissa on iso ero.

– Influenssaviruksella genomi on kahdeksassa palasessa. Sen lisäksi, että virus muuttaisi yhden kohdan, se voi muuttaa kokonaisen palasen kerrallaan. Siksi se saattaa ottaa valtavia harppauksia kerralla, selittää Tarja Sironen.

HI-virus puolestaan on yksi kaikkein nopeimmin muuntuvista viruksista. Siihen ei ole pystytty kehittämään rokotetta, ja lääkkeitäkin on pitänyt kehittää jo lukuisia.

– Olen lukenut sellaisen arvion, että hiv-potilaan elimistöstä löytyvät viruksen kaikki mahdolliset mutaatiot joka hetki. Kaikki variaatiot ovat valmiina. Jokin niistä pärjää lääkettäkin vastaan.

Näihin viruksiin verrattuna COVID-19-rokotteen kehittäjillä on paljon pehmeämpi pala purtavana. Kunhan toimiva rokote saadaan, virus ei siltä heti karkaa.

Rokote käsivarteen.
Oxfordin yliopiston ja AstraZeneca-lääkeyrityksen COVID-19-rokotetta pidetään ehkä lupaavimpana. Sen ihmiskokeet keskeytettiin tällä viikolla, kunnes selviää, liittyykö yhden testatun sairastuminen rokotteeseen. Tässä rokotetaan vapaaehtoista Sowetossa Etelä-Afrikassa kesäkuussa. Siphiwe Sibeko / EPA

Tällä huimalla panostukselle, jota rokotteen kehittelyyn nyt pannaan, rokote varmasti onnistuu, sanoo Sironen. Hän kuitenkin lisää, että vasta aika näyttää, kuinka pitkän suojan rokote antaa. Ehkä rokotus pitää uusia joka vuosi, kuten influenssoja vastaan.

Entä lääke? Siitä on puhuttu paljon vähemmän.

– Remdesiviiristä on vahvin näyttö siitä, että se ainakin jonkin verran lievittää oireita. Mutta on ihan totta, että vaikka solumallissa on testattu valtava määrä erilaisia molekyylejä, niin aika harva on edennyt eläinkokeisiin tai tuottanut niissä hyviä tuloksia, kertoo Sironen.

Realismin nimissä hän muistuttaa, että viruslääkkeiden kehittäminen on yleensäkin haastavaa. Virukset käyttävät lisääntymiseen isäntälajin soluja, ja lääke pitäisi pystyä kohdistamaan niin, ettei virusta nujerrettaessa tapeta myös solua.

SARS-CoV-2:lla kaikki osui kohdalleen

Evoluutiossa käy usein myös niin, että viruksen ja isäntälajin välille löytyy tasapaino. Eihän viruksen kannata isäntäänsä tappaa. Voi olla hyvinkin mahdollista, että myös COVID-19 muuttuu aikaa myöten vähemmän vakavaksi infektioksi, sanoo apulaisprofessori Tarja Sironen.

– Sellainenkin hypoteesi on esitetty, että myös neljä nuhakuumetta aiheuttavaa kausikoronaa olisivat aikoinaan aiheuttaneet jonkinlaisen epidemian tai pandemian ja pikku hiljaa muuntuneet heikommiksi.

Se jää hypoteesiksi, koska nykyisenlaista virustutkimusta ei ollut, kun kausikoronavirukset hyppäsivät ihmiseen.

Vanha piirroskuva lepakosta ja yksityiskohtia kasvoista ja kallosta.
Toisin kuin ihmiset, lepakot ovat tulleet ikiaikoja sairastumatta toimeen koronavirusten kanssa. Tämä Kiinassa käyneen skottilaisen eläintutkijan John Andersonin piirtämä villaturkkiherkko vuodelta 1878 on lähisukua aasianherkolle, josta monet tutkijat arvelevat SARS-CoV-2-viruksen päätyneen ihmiseen.The History Collection / Alamy / AOP

Kansainvälisen Eco-Health Alliance (siirryt toiseen palveluun) -järjestön vasta-ainetestit, joita se teki Kiinassa ennen COVID-19:n ilmaantumista, osoittivat muidenkin koronavirusten kokeilevan, olisiko ihmisestä isännäksi.

400 lounaiskiinalaiselle tehdyissä testeissä kuuden verestä löytyi muisto todennäköisesti lepakoilta saadusta mutta tuntemattomaksi jääneestä koronataudista.

– Sitten tuli virus, jonka näkökulmasta kaikki osui kohdalleen. Se onkin sitten iso tutkimuskysymys, mikä oli ratkaiseva tekijä, vai oliko tämä vain sattumaa, sanoo Tarja Sironen.

Sitä hän ei ryhdy ennustamaan, milloin COVID-19 mahdollisesti asettuu lieväoireiseksi taudiksi. Mutaatioiden hitaus ei siinä suhteessa olekaan etu.

– Genomia katsoessamme osaamme vielä valitettavan huonosti ennustaa, tarkoittaako esimerkiksi jonkin aminohapon muuttuminen viruksen biologisten ominaisuuksien muuttumista. Siksi on mahdoton ennustaa, kuinka kauan tässä vielä menee.

Voit keskustella tästä aiheesta lauantaihin kello 23:een saakka.

Lue myös:

Täältä voit lukea kaikki tuoreimmat uutiset koronaviruksesta.

Koronalääkkeitä on ollut helpompi määrätä kuin tutkia – suomalaisprofessorin mukaan myyntilupia on annettu liian vähäisillä tiedoilla

Tilaa uutiset koronaviruksesta

Saat Ylen tärkeimmät koronavirusuutiset sähköpostiisi kerran päivässä.

Siirry tilaamaan

Luotettavia koronauutisia nopeasti suoraan puhelimeesi

Lataa Yle.fi-sovellus